top of page

By spacemt354

A land - 65 Million Years in the Making. Welcome to Isla Nublar and the thrilling adventures that await in Jurassic World. One of the most visited places on the planet, Jurassic World brings to life creatures from a once lost world of dinosaurs. The childlike awe is put on center-stage as soon as you step foot onto the main street of Jurassic World and the memorable John Williams score envelops you in majesty. 

Gyrospheres: Excursions to a Lost World


Attraction Statistics

E-Ticket Dark Ride Hybrid Coaster

Height Minimum - 44 inches

Hourly Capacity - 1,670 guests

Express Pass - Yes

Wheelchair Transfer - Yes

Meandering towards the right side of the Main Street of Jurassic World - you can walk up to the pathway that leads to the land's signature attraction - Gyropheres: Excursions to a Lost World. Using a newly patented trackless coaster hybrid, guests can travel along in the infamous gyrospheres from the film, Jurassic World - and embark on an unforgettable adventure into the jungles of earth, 65 million years ago.

Queue

Walking along the pathway in order to get to the attraction loading area, you trek up the side of the Isla Nublar Mountain range, and walk along a winding narrow path that continues to ascend past various plantlike from a prehistoric age. Trees from another time, foliage from the Jurassic period, and plentiful colors surrounding the guests as you continue the journey. As you get closer to the 65 foot peak where the loading zone is, you get a panoramic view of the park as the trees morph into smaller, higher altitude plant-life, which gives the guests a more less of a disrupted view of the surroundings beyond the Jurassic jungle. As you approach the loading zone, the famous John Williams/Michael Giacchino Jurassic Park theme begins to play, and you know you are about to embark on something unlike anything else in a theme park. At the loading area, video screens detail the safety instructions and information necessary before boarding your vehicles.

The gyroshere is a 6-seater vehicle capable of a wide range of motion that involves forward, backward, and roller coaster type drops and stops. Guests must be at least 42 inches tall to ride. Those who experience motion sickness, pregnant, have back/neck pain, or are frightened by loud noises, large animatronics, or any other conditions that may be aggravated by this adventure should not ride.

Excursion Map

Before you load, you are shown the path that you will take along in the jungles of Isla Nublar. You can see that you'll pass over the Discovery Canoes before going into the great beyond of the mountain range.

Ride Experience

Departing the load area you travel across a small bridge as a piano version of the Jurassic Park theme plays inside your gyrosphere for all to hear and be immersed by. Looking around at the sprawling greenery, you're transported into a world far lost in time. Continuing on you see a small pack of water based dinosaurs by a creek, that slightly move as you glide past them. The music continues to swell inside the gyrosphere, until you reach the brachiosaurus pack, where the music booms as an homage to the original Jurassic Park

You can even say to yourself...'they do move in herds'

The beauty and majesty of the adventure is compounded when you gaze over the edge to your right and see the Discovery Canoes floating past on a small river, with additional Brontosaurus below, grazing on the trees and the plant life.

Up ahead is a spring area that has a Triceratops drinking from the water and another grazing from a bush. They let out a bellow and continue to graze and drink from the tropical landscape. As you continue on past the spring, you begin to hear a more insidious roar....from something that sounds menacing and terrifying. You see trees rattle up ahead, yet your gyrosphere continues to pursue the original course as intended. The roar is heard once more, this time, almost as if it is on top of you.

Entering the forest where the ravenous roars were heard from - you then come face to face with Jurassic World's newest attraction - the Indominous Rex. Yet, something is wrong. The I-Rex is not even supposed to debut for another few months and is supposed to be locked away. Sirens rain down and the I-Rex comes to life as an animatronic in front of your vehicle as your gyrosphere goes into survival mode and dives down the canyon into a sharp turn around a banked canvas. You narrowly miss being the I-Rex's lunch and you hear the massive dino racing after you as you careen through the canyons.

Twisting and turning around, you read a max speed of around 35 mph, before a sharp banked curve that gives the attraction the element of thrill, and then a steep 30 foot drop into the basin below. The two drops plus the sharp, quick turns seem to be enough to escape the I-Rex's wrath, as your gyrosphere slows down and an announcement is made in your gyrosphere to return to the dock as the tour is on lockdown. Then suddenly, you find yourselves at the foothills of the Jurassic World Aviary, which breaks open and you can hear birds flying everywhere, as the I-Rex roars behind it. Helicopters can be heard swooping in and your vehicle launches off yet again around a series of harrowing turns and dicey obstacles. You hear the cry of raptors and you see one running alongside your gyrosphere, it lunges at you and appears to knock your gyrosphere into a turn, but in reality it wasn't going after you, it was moving your gyrosphere away from the incoming I-Rex attack. As you hear the battle taking place behind you, the gyrosphere stops, and you might be freaked out at the probablility of the I-Rex getting you from behind. Yet your gyrosphere is stopped for a reason, as out of the trees, a massive T-Rex comes out, ready for a fight. It roars and a fight between the T-Rex and the I-Rex begins, which allows you to sweep away and head back towards the unload dock.

Once the battle has finished, the animatronic of the T-Rex looks at you and then looks out onto Jurassic World and lets out a thunderous roar as if to say - this is my world. You unload and read the service announcements that the I-Rex has been placed under captivity and the Island's attractions are back open.


Discovery Canoes

Attraction Statistics

B-Ticket 

Hourly Capacity - 500 guests

Express Pass - No

 

The Discovery Canoes are offered to guests who want to canoe down a river 65 million years in the making. You travel through the exotic land and see dinosaurs in their natural habitats from up close and unique perspectives that you don't get anywhere else in the land. Some portions of the attraction overlap with the Gyrosphere attraction, offering views of the rolling attraction vehicles above from the water below. The entire river should take around 10-15 mins to canoe through

John Hammond Center

 

Attraction Statistics

C-Ticket Moving Theater
Hourly Capacity - 1,200 guests
Express Pass - No
Wheelchair Transfer - No

As you go through the main entrance of the large 65 foot triangular building in the center of the land, you are immediately thrust into an atrium of exhibits to explore. In the center hub of the lobby are interactive consoles that teach you about the size and scope of the different dinosaur species. Surrounding the hub are three separate exhibits

Exhibit A - The Earth Goes Round - a touch-screen based interactive game that brings guests back to the Jurassic Period to show how the Earth has evolved from that era.
Exhibit B - Dino Challenge - a trivia game about the dinosaurs in our land.
Exhibit C - Velociraptor Valley - a detailed look at one of the most intelligent animals to ever walk the Earth.

To the left of the main entrance is the Museum of Discovery. A museum composed of the fossilized remnants of some of the dinosaurs in the land, included the massive T-Rex skeleton. This is also where the queue for the "Lost World of the Dinosaurs" attraction begins.

Prelude
After gazing at the wonder of the Visitors Center main lobby atrium exhibits, guests can enter the queue for this moving-theater show, which details a behind-the-scenes look the science and discovery that has made Jurassic Park a reality. Beginning with the excavation of fossilized mosquitoes, to the extraction process of paleo-DNA, and finally to the breakthroughs of modern genetic splicing, guests sit in a rotating theater and observe the John Hammond laboratories at work, with a glimpse at the future park inhabitants.

Attraction Layout​

 

The attraction will be divided into 6 segments. The theater will rotate around the segments in a counter-clockwise formation similar to the motion of Carousel of Progress at the Walt Disney World Resort.

1 - Introductory Segment

As guests enter the 250 seat rotating theater, they see a dark screen in front of them as they find their seats. As the lights dim, Dr. Henry Wu, Jurassic World's chief geneticist, appears on screen.


Dr. Wu: "Hello, and welcome to our Paleo-Genetic Research Center. My name is Dr. Wu, and today I will lead you on a tour of our facility, and show the breakthroughs we have uncovered, 65 million years in the making. With the guidance and support of our visionary leader, the late John Hammond, we are proud to give you a behind the scenes look at how this dream became a reality. Before we begin, we'd like to share a few words from Mr. Hammond, that he wished to send to all who experience his park."

(John Hammond's voiceover is heard with an image of the park's logo)

John Hammond: "To anyone and everyone here, welcome. There was once a time where I thought this dream was extinct. But just like the dinosaurs, we've been able to bring it back to life! This park will be absolutely stunning as we have some of the best and brightest scientists leading us further on in the 21st century of scientific discovery. Here you'll get a glimpse at what we've been working on. We spared no expense, and we hope you enjoy the park and all the wonder it has to offer."

(A piano version of the Jurassic Park theme song plays as the outro, as the theater rotates to the next scene)


2 - When Dinosaurs Ruled the Earth

(The theaters pan around to reveal another screen with a montage of video which follows Dr. Wu's narration)


Dr. Wu: "Hundreds of millions of years ago, dinosaurs ruled the earth. But they weren't the only creatures that inhabited the earth. Mosquitoes, creatures that feed on the blood of animals, fed on the blood of dinosaurs as well. Often times, tree sap flows over insects and traps them. The sap preserves them like a fossil, something that we call amber, preserving the insects as well as the dinosaur blood. Blood contains billions of strands of DNA, the building blocks of life. Decades ago we uncovered our first ambers, which led us to where we are today, isn't that right Mr. DNA?"

(A cartoon DNA shows up on the screen)
Mr. DNA: "Absolutely Henry! We were lucky that our extraction procedures were able to preserve mostly full paleo-DNA strands...that's the fancy way of saying Dino DNA. Did you know a single strain of DNA contains 3 Billion genetic codes? (A fast moving genetic code image appears on screen) If we looked at screens like these once a second for eight hours a day, it would take us 2 years to look at the entire DNA strand. It's that long!"

Dr. Wu: "Which is why our geneticists have developed efficient extraction techniques over the years, as we will show you how the process has modernized over time."

3 - The Science of Dino DNA

(Theater rotates into a computerized laboratory surrounded by 90s technology, Dr. Wu's narration continues)

Dr. Wu: "Back when InGen was first developing genetic software to encode the extracted dinosaur DNA, it was a long and slow process to get to where we are today. At the time though, these were very fast data networks by Cray XMP supercomputers, creating an incredibly powerful genetic factory for us to use.

We would start by encoded the extracted DNA in the computers. Dino DNA, like humans, is made up of four basic compounds - adenine, cytosine, guanine, and thymine, however much of the DNA extracted was either fragmented or incomplete, so the first thing we had to do is repair it. Here you can see the damage on Gene 1201."

The computer screen in the lab shows the image below:


Paleo-DNA Extraction
1 - GCGTTGCTGG CGTTTTTCCA TAGGCTCCGC CCCCCTGACGT
61 - CGCAACGACC GCAAAAAGGA ATCCGTCCGC GGGGGACTGCA
121 - TGTTCCGACC CTGCCGCTTA CCGGATACCT GTCCGCCTTTT
181 - ACAAGGCTGG GACGGCGAAT GGCCTATGGA CAGGCGGAAAA
301 - GGCCTATCGG CCCCTGCGAA CTTTACGGCAT GGTATTAACGC
721 - CCGGATAGCC GGGGACGCTT GAAATGCCGTA CCATAATTGCG

1201 - ATTAGCCGTT GTGCT****CCTGTCGTTG GGTATTAACGC

Dr. Wu: "From here, we had to cut the DNA at that point, using what are called restriction enzymes, such as SM503, which align the cut fragments with the missing compounds, like so..."

Restriction Enzyme DNA-splicing

1 - GCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACG
61 - CGCAACGACCGCAAAAAGGAATCCGTCCGCGGGGGACTGC
Nsp04
121 - TGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTT
181 - ACAAGGCTGGGACGGCGAATGGCCTATGGACAGGCGGAAA
434 DnxT1
301 - GGCCTATCGGCCCCTGCGAACTTTACGGCATGGTATTAACG
721 - CCGGATAGCCGGGGACGCTTGAAATGCCGTACCATAATTGC
SM503
1201 - ATTAGCCGTTGTGCT *AG* CCTGTCGTTGGGTATTAACGCAA

Dr. Wu: "Once the restriction enzymes do their work, our computers would produce the new DNA strand, which we'd then have to combine with other amphibian DNA to make a complete genetic code. It was like putting a puzzle together. And a ton of work. Thankfully at InGen, we are creating the world of tomorrow, today!"(Theater rotates to the next laboratory)


4 - Laboratories at the Park

(As you look in the lab you see AA geneticists in lab coats peering into microscopes, observed data on HD screens, egg stations organized throughout, and a wall of amber fossils to the right hand side.)(On the loud speaker you hear a deep voice give an announcement)

"A reminder - The boats from mainland will be leaving at 1900 hours. All personnel, be at the dock no later than 1845. No exceptions"

The theater comes to a stop, you see a biohazard sign on the left entrance door which reads:

Caution:
Biological Hazard
Teratogenic Substances - Pregnant Women Avoid Exposure to this Area

Danger:
Radioactive Isotopes In Use
Carcinogenic Potential

Dr. Wu: "Don't worry about the signs folks, they are just up for legal purposes. I can assure you everything we do in the InGen labs here at Jurassic World is completely safe. As you can see we have come a long way in a short amount of time. When Masarni Global acquired InGen, it was at a time where people barely even used cell phones. Now you can see the advances in technology upon us. Oh look, I believe we are about to see an egg hatch"

(You see an egg in the center of the lab beginning to move, and the TV monitors on the sides switch to the egg)

Dr. Wu: "This is one of the wonders of our park. There is no unauthorized breeding in Jurassic World. It's one of our security precautions. This is always such a joy to see first hand. It's a Velociraptor as well. Get a good look folks, as we move on to the future of InGen technologies."

5 - The Future of DNA

(As the theater rotates you see another section of the research lab and a montage video of the people working in the labs)

Dr. Wu: "Scientific and technological advancements have accelerated at an astronomical rate, and at InGen, being 'tomorrow, today' could never be more true. With new equipment such as the Hammond XP20, we can now decode hundreds of trillions of paleo-DNA in seconds, and revive extinct animals in merely hours. The days of filling in dino DNA with frog DNA are long in the past. We strive for the future in discovery. With the recent discovery that soft tissue from iron chelators produce more DNA than we ever thought possible, we can put together the genetic puzzle pieces much faster and in more sophisticated ways than ever before.

We are even working on a new project for the park that involves gene splicing and the combination of different dino DNA. While this experiment is still in beta-testing mode, it's just another example of how we are using science to recreate once impossible worlds.

6 - Conclusion and Exit
On behalf of everyone at the John Hammand Center for Paleo-Genetic Research, thank you for exploring our behind-the-scenes look at the creative process behind dino engineering. At the end of the tour, you can exit the theater in to the Hammond Creation Labs, and test out some of our technology for yourselves. Thank you again and enjoy your day here at Jurassic World."

Easter Eggs:
- "Lost World of the Dinosaurs" was the title of Dr. Alan Grant's book in Michael Crichton's novel,Jurassic Park.
- "65 Million Years in the Making" was part of the tagline for the 1993 Jurassic Park film.
- Mr. DNA was an animated figure in the instructional research video in the 1993 film.
- The loud-speaker announcement in the 4th segment is also heard in the same lab setting from the 1993 film.
- The animal bred in the 4th segment is a Velociraptor, a tribute to the "egg hatching" scene from the 1993 film.​

Restaurants and Shops

bottom of page